Skip to main content

Advertisement

Table 1 Primers and probes used for diagnostic and phylogenetic analysis

From: Imported scrub typhus: first case in South America and review of the literature

Primer ID Sequence Annealing temp. PCR Reference
16sU17F AGAGTTTGATCCTGGCTCAG 56 °C First [30]
16sOR1198R TTTCCTATAGTTCCCGGCATT 56 °C First & second
16sO79F ATTAATGCTGAGCTTGCTTAGCAT 56 °C Second
Otr47_263F GTGCTAAGAAARGATGATACTTC 54 °C First [31]
Otr1780R AAATCGCCTTTAAACTAGATTTACTTATTA 54 °C First & second
Otr47F TAAAGGTTAAGTTTATGAAAAAGGCATTT 54 °C Second
Otr56_498F AATTAGTTTAGAATGGTTACCAC 54 °C First
r56_585F AATGTCTGCGTTGTCGTTGC 54 °C Second
r56_2057 TCCACATACACACCTTCAGC 54 °C First & second [32]
OtsuFP630 AACTGATTTTATTCAAACTAATGCTGCT 60 °C Real time [5]
OtsuRP747 TATGCCTGAGTAAGATACRTGAATRGAATT 60 °C Real time [5]
OtsuPR665 6FAM-TGGGTAGCTTTGGTGGACCGATGTTTAATCT-TAMRA 60 °C Real time [5]