Skip to main content

Advertisement

Table 1 List of ribosomal 18S primers used in this study

From: First report of Entamoeba moshkovskii in human stool samples from symptomatic and asymptomatic participants in Kenya

Genus-specific primers (First PCR)
Entamoeba genusE-1 5' TAAGATGCACGAGAGCGAAA 3' (forward primer)
E-2 5' GTACAAAGGGCAGGGACGTA 3' (reverse primer)
Species-specific primers (Second nested multiplex PCR)
E. histolytica speciesEH-1 5' AAGCATTGTTTCTAGATCTGAG 3' (forward primer)
EH-2 5' AAGAGGTCTAACCGAAATTAG 3' (reverse primer)
E. moshkovskii speciesEM-1 5' GAAACCAAGAGTTTCACAAC 3' (forward primer)
EM-2 5' CAATATAAGGCTTGGATGAT 3' (reverse primer)
E. dispar speciesED-1 5' TCTAATTTCGATTAGAACTCT 3' (forward primer)
ED-2 5' TCCCTACCTATTAGACATAGC 3' (reverse primer)